GMOMETHODS | EURL GMFF

« Back to search

QT-TAX-ZM-014 Species specific method icon

General information

Tested in:

Maize

Genetic target:

ADH1

Description:

Quantitative PCR method for detection of maize alcohol dehydrogenase 1 gene (ADH1) (EURL GMFF, 2007)

Comments:

Taxon-specific methods may generate amplicons with different sequence or length in different plant varieties.

Method details

Specificity:

Species specific

Analysis type:

Quantitative

Assay:

Real-time PCR (Simplex)

Amplicon sequence:

CGTCGTTTCCCATCTCTTCCTCCTTTAGAGCTACCACTATATAAATCAGGGCTCATTTTCTCGCTCCTCACAGGCTCATC
TCGCTTTGGATCGATTGGTTTCGTAAGTGGTGAGGGACTGAGGGTCTCGGAGTGG
Genbank ID: AY691949

Amplicon size:

135 bp

Oligos:

Type	Name(s)	Sequence	Length	Target
Primer forward	Zm Adh1 primer F / Zm Adh1primer F / Zm adh1-F / Adh1 primer F	CGTCGTTTCCCATCTCTTCCTCC	23 bp	ADH1
Primer reverse	Zm Adh1primer R / Zm adh1-R / Adh1 primer R / Zm adh1 primer R	CCACTCCGAGACCCTCAGTC	20 bp	ADH1
Probe	Zm Adh1 probe / Zm Adh1(Probe) / Zm adh1-P / Adh1 probe	VIC-AATCAGGGCTCATTTTCTCGCTCCTCA-TAMRA	27 bp

Other methods validated in combination

QT-EVE-ZM-014

European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR - Validation Report and Protocol - Report on the Verification of Performance of a DNA Extraction Method for Maize Grains. Luxembourg (Luxembourg): Publications Office of the European Union. JRC42964. 2007. | 10.2788/62889 | 2007
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR - Validation report, validated method and maize seeds sampling and DNA extraction. Luxembourg (Luxembourg): Publications Office of the European Union. JRC84134. 2013. | 10.2788/22173 | 2013
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Event Bt11 Using Real-time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC48909. 2008. | 10.2788/4370 | 2008
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Event 3272 Using Real-time PCR - Validation Report - corrected version 1. JRC94616. 2014. | 2008
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Event 3272 Using Real-time PCR - Protocol. JRC94616. 2008. | 2008
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MIR162 by Real-time PCR. Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC68155. 2011. | 10.2788/44161 | 2011
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. In-house Validation of an Event-specific Method for the Quantification of Maize Bt176 Using Real-time PCR. Validation Report. Luxembourg (Luxembourg): Publications Office of the European Union. JRC68068. 2011. | 10.2788/35536 | 2011
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize 5307 by Real-time PCR - Validation Report. JRC93074. 2014. | 2014
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize 5307 by Real-time PCR - Validated Method. JRC93074. 2014. | 2014
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MZHG0JG Using Real-time PCR - Validation Report. JRC112301. 2018. | 2018
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MZHG0JG Using Real-time PCR - Validated Method. JRC112301. 2018. | 2018
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MZIR098 Real-time PCR - Validation Report. JRC114043. 2018. | 2018
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MZIR098 Real-time PCR - Validated Method. JRC114043. 2018. | 2018