GMOMETHODS | EURL GMFF

« Back to search

QT-TAX-ZM-002 Species specific method icon

General information

Tested in:

Maize

Genetic target:

HMG

Description:

Quantitative PCR method for detection of maize high-mobility-group gene (HMG) (ISO 21570:2005)

Comments:

Taxon-specific methods may generate amplicons with different sequence or length in different plant varieties.

Method details

Specificity:

Species specific

Analysis type:

Quantitative

Assay:

Real-time PCR (Simplex)

Amplicon sequence:

TTGGACTAGAAATCTCGTGCTGATTAATTGTTTTACGCGTGCGTTTGTGTGGATTGTAGGACAAGGCTCCCTATGTAGC
Genbank ID: AJ131373.1

Amplicon size:

79 bp

Oligos:

Type	Name(s)	Sequence	Length	Target
Primer forward	ZM1-F / MaiJ-F2 / Hmg F / hmg primer F / hmg primer 1 / MaiJ-F	TTGGACTAGAAATCTCGTGCTGA	23 bp	HMG
Primer reverse	ZM1-R / mhmg-rev / Hmg R / hmg primer R / hmg primer 2 / mhmg-R	GCTACATAGGGAGCCTTGTCCT	22 bp	HMG
Probe	Probe ZM1 / ZM1 / Mhmg-probe / hmg P / hmg probe P / hmg probe / mhmg-P / hmg-probe	FAM-CAATCCACACAAACGCACGCGTA-TAMRA	23 bp

Other methods validated in combination

QT-EVE-ZM-020

ISO 21570:2005 Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods. 2005 | 2005
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC56609. 2009 | 10.2788/59036 | 2009
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantitation of Maize Line TC1507 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA extraction of maize. Luxembourg (Luxembourg): Publications Office of the European Union. JRC32120. 2005. | 2005
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC32187. 2006. | 10.2788/31820 | 2006
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific method for the quantification of maize line MON 88017 using real-time PCR v. 1.01 - Validation report, validated method and DNA extraction. Luxembourg (Luxembourg): Publications Office of the European Union. JRC84136. 2013. | 10.2788/22579 | 2013
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC48919. 2008. | 10.2788/43570 | 2008
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Line MON 89034 Using Real-time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC48921. 2008. | 10.2788/68713 | 2008
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize 98140 by Real-time PCR - Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC68064. 2011. | 10.2788/34828 | 2011
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR - Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC74374. 2012. | 10.2788/45380 | 2012
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Validated Method - Sampling and DNA Extraction of Maize TC15O7. Luxembourg (Luxembourg): Publications Office of the European Union. JRC76621. 2012. | 10.2788/64013 | 2012
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report - Corrected version 1. JRC96323. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validated Method. JRC96323. 2015. | 2015
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method. JRC102146. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validated Method. JRC102146. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87403 Using Real-time PCR - Validation Report. JRC111720. 2018. | 2018
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87403 Using Real-time PCR - Validated Method. JRC111720. 2018. | 2018
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87419 Using Real-time PCR - Validation Report. JRC117701. 2019. | 2019
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87419 Using Real-time PCR - Validated Method. JRC117701. 2019. | 2019
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87429 Using Real-time PCR - Validation Report. JRC126240. 2021. | 2021
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 87429 Using Real-time PCR - Validated Method. JRC126240. 2021. | 2021
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 95379 Using Real-time PCR - Validation Report. JRC130976. 2022. | 2022
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize MON 95275 Using Real-time PCR - Validation Report". JRC135660. 2023. | 2023
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of maize MON 95275 by Real-time PCR - Validated Method. JRC135660. 2023. | 2023
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Maize Event MON 94804 Using Real-time PCR - Validation Report. JRC137351. 2024. | 2024
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of maize MON 94804 using Real-time PCR - Validated Method. JRC137351. 2024. | 2024