GMOMETHODS | EURL GMFF

« Back to search

QT-TAX-GM-002 Species specific method icon

General information

Tested in:

Soybean

Genetic target:

LE1

Description:

Quantitative PCR method for detection of soybean lectin gene (LE1) (ISO 21570:2005)

Comments:

Taxon-specific methods may generate amplicons with different sequence or length in different plant varieties.

Method details

Specificity:

Species specific

Analysis type:

Quantitative

Assay:

PCR (Simplex Real Time)

Amplicon sequence:

CCAGCTTCGCCGCTTCCTTCAACTTCACCTTCTATGCCCCTGACACAAAAAGGCTTGCAGATGGGCTTGCCTTC
Genbank ID: K00821

Amplicon size:

74 bp

Oligos:

Type	Name(s)	Sequence	Length	Target
Primer forward	lecF / GM1-F / Lec for2 / Le1 forward / Le1 primer1 / lec primer 1	CCAGCTTCGCCGCTTCCTTC	20 bp	LE1
Primer reverse	lecR / GM1-R / GMO3-126 Rev / Le1 reverse / Le1 primer2 / lec prmer 2	GAAGGCAAGCCCATCTGCAAGCC	23 bp	LE1
Probe	GM1 / Lec Probe / Le1 / Le1 probe / lecP / lec probe	FAM-CTTCACCTTCTATGCCCCTGACAC-TAMRA	24 bp

Other methods validated in combination

QT-EVE-GM-005

European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean Line 40-3-2 Using Real-time PCR - JRC Validated Methods, Reference Methods and Measurements Report - Corrected version 1. Luxembourg (Luxembourg): Publications Office of the European Union. JRC42837. 2017. | 10.2760/720444 | 2017
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean Line MON 89788 Using Real-time PCR v 1.01 - Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC84189. 2013. | 10.2788/20464 | 2013
ISO 21570:2005 Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods. 2005 | 2005
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean Event DP-305423-1 Using Real-time PCR v. 1.01 - Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC84080. 2013. | 10.2788/21515 | 2013
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean Event DP-356043-5 Using Real-time PCR v.1.01 - Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC84118. 2013. | 10.2788/16469 | 2013
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean MON 87701 Using Real-time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC68071. 2011. | 10.2788/38101 | 2011
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR. Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC68070. 2011. | 10.2788/37626 | 2011
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean MON87705 Using Real-time PCR. Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC74376. 2012. | 10.2788/48383 | 2012
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean MON87769 Using Real-time PCR. Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC74371. 2012. | 10.2788/4544 | 2012
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean DAS-68416-4 Using Real-time PCR. Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC89867. 2014. | 10.2788/87396 | 2014
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR - Validation Report and Validated Method. Luxembourg (Luxembourg): Publications Office of the European Union. JRC81896. 2013. | 10.2788/90943 | 2013
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean DAS-81419-2 by Real-time PCR - Validation Report. JRC95211. 2015. | 2015
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean DAS-81419-2 by Real-time PCR - Validated Method. JRC95211. 2015. | 2015
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean DAS-44406-6 by Real-time PCR - Validation Report. JRC95249. 2015. | 2015
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean DAS-44406-6 by Real-time PCR - Validated Method. JRC95249. 2015. | 2015
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validation Report. JRC102147. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validated Method. JRC102147. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR - Validation Report. JRC102143. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR - Validated Method. JRC102143. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Soybean Event MON 94313 Using Real-time PCR - Validation Report. JRC139074. 2024. | 2024
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of soybean MON 94313 using Real-time PCR - Validated Method. JRC139074. 2024. | 2024