GMOMETHODS | EURL GMFF

« Back to search

QT-TAX-GH-015 Species specific method icon

General information

Tested in:

Cotton

Genetic target:

ACP1

Description:

Quantitative PCR method for detection of cotton fiber-specific acyl carrier protein gene (ACP1) (EURL GMFF, 2008)

Comments:

Nucleotide changes have been observed in EMBL record with accession number U48777 in positions 7 and 51 of the amplicon sequence. Taxon-specific methods may generate amplicons with different sequence or length in different plant varieties.

Method details

Specificity:

Species specific

Analysis type:

Quantitative

Assay:

Real-time PCR (Simplex)

Amplicon sequence:

ATTGTGWTGGGACTTGAGGAAGAATTCGGAATCACGGTGGAAGAGGACAAYGCACAATCCATCACAACTGTTCAAG
Genbank ID: U48777.1

Amplicon size:

76 bp

Oligos:

Type	Name(s)	Sequence	Length	Target
Primer forward	acp1 primer forward / acp1 primer 1	ATTGTGATGGGACTTGAGGAAGA	23 bp	ACP1
Primer reverse	acp1 primer reverse / acp1 primer 2	CTTGAACAGTTGTGATGGATTGTG	24 bp	ACP1
Probe	acp1 probe /	FAM-ATTGTCCTCTTCCACCGTGATTCCGAA-TAMRA	27 bp

Other methods validated in combination

QT-EVE-GH-003

European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Cotton Line MON 1445 Using Real-time PCR - Validation Report and Protocol - Report on the Validation of a DNA Extraction Method for Cotton Seeds and Grains: Corrected version 1. Luxembourg (Luxembourg): Publications Office of the European Union. JRC48853. 2017. | 10.2760/11930 | 2017
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR - Validation Report and Validated Method - v. 1.01. Luxembourg (Luxembourg): Publications Office of the European Union. JRC84173. 2013. | 10.2788/18510 | 2013
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Cotton Line MON 15985 Using Real-time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC48908. 2008. | 10.2788/4378 | 2008
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Cotton MON 88913 Using Real-time PCR - Validation Report and Protocol. Luxembourg (Luxembourg): Publications Office of the European Union. JRC56608. 2009. | 10.2788/58818 | 2009
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Cotton MON 88701 Using Real-time PCR - Validation Report. JRC102142. 2016. | 2016
European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission. Event-specific Method for the Quantification of Cotton MON 88701 Using Real-time PCR - Validated Method. JRC102142. 2016. | 2016