QT-TAX-BN-001
|
General information
| Tested in: |
Oilseed Rape
|
| Genetic target: | FatA |
| Description: | Quantitative PCR method for detection of oilseed rape acyl-ACP thioesterase gene (FatA), A subgenome (EURL GMFF, 2014) |
| Comments: | A novel A-genome specific oilseed rape PCR detection method for acyl-ACP thioesterase (FatA) gene in Brassica napus, Brassica rapa and Brassica juncea. The amplified FatA(A) fragment is 126 bp in a majority of Brassica napus varieties, in all Brassica juncea varieties and in some of the Brassica rapa varieties tested; it is of 129 bp in a minority of Brassica napus varieties and in some Brassica rapa varieties tested. Taxon-specific methods may generate amplicons with different sequence or length in different plant varieties. |
Method details
| Specificity: | Species specific |
| Analysis type: | Quantitative |
| Assay: | Real-time PCR (Simplex) |
| Amplicon sequence: |
ACAGATGAAGTTCGGGACGAGTACTTGGTTTTCTGTCCTCGAGAACCCAGGTGAAGAAGAATCATCATGCTTCCCTTATA ATTGCTAGTTAAACAGTTAATATTTAAGCATGTGGATCTCAACCTG Genbank ID: X87842 |
| Amplicon size: | 126 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | 09-0-3249 / FatA(A) primer 1 | ACAGATGAAGTTCGGGACGAGTAC | 24 bp | FatA |
| Primer reverse | 09-0-3251 / FatA(A) primer 2 | CAGGTTGAGATCCACATGCTTAAATAT | 27 bp | FatA |
| Probe | 09-QP-87 / FatA(A) probe | FAM-AAGAAGAATCATCATGCTTC-MGBNFQ | 20 bp |
