European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QT-EVE-ZM-001 Event specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward VCO-01981-5 primer F / CCACTGAACGTCACCAAGAAGA 22 bp 5'-host genome
Primer reverse VCO-01981-5 primer R / GCCGCTACTCGAGGGATTTA 20 bp insert
Probe VCO-01981-5 probe / FAM-CAGTACTCAAACACTGATAG-MGB 20 bp

Other methods validated in combination