QT-CON-00-008
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event GA21 (G21) | MON-00021-9 (Maize)
|
| Genetic target: | OTP / mEPSPS |
| Description: | Quantitative PCR method for detection of the junction between an optimized transit peptide sequence and the point mutated epsps gene from maize (Shindo et al., 2002) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Construct specific |
| Analysis type: | Quantitative |
| Assay: | Real-time PCR (Simplex) |
| Amplicon sequence: |
GAAGCCTCGGCAACGTCANNNNNNNNNNAAGGATCCGGTGCATGGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGCTTTCCAACCGGAT |
| Amplicon size: | 133 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | GA21 3-5' / | GAAGCCTCGGCAACGTCA | 18 bp | OTP |
| Primer reverse | GA21 3-3' / | ATCCGGTTGGAAAGCGACTT | 20 bp | mEPSPS |
| Probe | GA21-2-Taq / | FAM-AAGGATCCGGTGCATGGCCG-TAMRA | 20 bp |
