European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-EVE-ZM-001 Event specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward VW01 / TCGAAGGACGAAGGACTCTAACG 23 bp 5'-host genome
Primer reverse VW03 / TCCATCTTTGGGACCACTGTCG 22 bp CaMV P-35S

Other methods validated in combination