European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-EVE-DC-005 Event specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward 27531 LB Specific fw / CGAGTAAATTCAAGCATGCCC 21 bp 5'-host genome
Primer reverse carLB-reverse / CCATATTGACCATCATACTCATTGC 25 bp insert

Other methods validated in combination