European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-EVE-DC-004 Event specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward RB Forward / ATTTCCACCTTCACCTACGATGG 23 bp insert
Primer reverse IFD-26407-2 Reverse / CACGGGTACAAATTGGATGAG 21 bp 3'-host genome

Other methods validated in combination