European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-EVE-DC-001 Event specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward LB123.2.38-R / CAATGCCTCGCCTTTTGTGG 20 bp 5'-host genome
Primer reverse LB inside.R / ACGTGAATGTAGACACGTCG 20 bp insert

Other methods validated in combination