European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-ELE-00-023 Element specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward t35S pCAMBIA c-F / CGGGGGATCTGGATTTTAGTA 21 bp CaMV T-35S pCambia
Primer reverse t35S pCAMBIA a-R / AGGGTTCCTATAGGGTTTCGCTC 23 bp CaMV T-35S pCambia