QL-ELE-00-022
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event RF3 | ACS-BN003-6 (Oilseed Rape)
|
| Genetic target: | bar |
| Description: | Qualitative PCR method for detection of phosphinothricin N-acetyltransferase (bar) gene (Barbau-Piednoir et al., 2014) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Element specific |
| Analysis type: | Qualitative |
| Assay: | Real-time PCR (Simplex) |
| Amplicon sequence: |
CGTCAACCACTACATCGAGACAANNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAACCGCAGGAGTGGAC |
| Amplicon size: | 69 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | Pat-Bar Fwd / | CGTCAACCACTACATCGAGACAA | 23 bp | bar |
| Primer reverse | Pat-Bar Rev / | GTCCACTCCTGCGGTTCCT | 19 bp | bar |