|
QL-ELE-00-020
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event Bt11 | SYN-BT011-1 (Maize)
GMO event MON810 | MON-00810-6 (Maize) |
| Genetic target: | Cry1A(b) |
| Description: | Qualitative PCR method for detection of Cry1A(b) gene (Barbau-Piednoir et al., 2014) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Element specific |
| Analysis type: | Qualitative |
| Assay: | Real-time PCR (Simplex) |
| Amplicon sequence: |
ACCGGTTACACTCCCATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTCGTGCCAGGTGCTG ACCGGTTACACCCCCATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTCGTGCCAGGCGCTG |
| Amplicon size: | 73 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | Cry1Ab_Bt_Cott_Fwd / | ACCGGTTACACTCCCATCGA | 20 bp | Cry1A(b) |
| Primer reverse | Cry1Ab_Bt_Cott_Rev / | CAGCACCTGGCACGAACTC | 19 bp | Cry1A(b) |