QL-ELE-00-019
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event 40-3-2 | MON-04032-6 (Soybean)
GMO event MON810 | MON-00810-6 (Maize) GMO event Bt11 | SYN-BT011-1 (Maize) GMO event RT73 (GT73) | MON-00073-7 (Oilseed Rape) GMO event RF3 | ACS-BN003-6 (Oilseed Rape) |
| Genetic target: | CP4-epsps |
| Description: | Qualitative PCR method for detection of CP4-epsps gene (Barbau-Piednoir et al., 2014) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Element specific |
| Analysis type: | Qualitative |
| Assay: | Real-time PCR (Multiplex) |
| Amplicon sequence: |
GCATGCTTCACGGTGCAAGCAGCCGGCCCGCAACCGCCCGCAAATCCTCTGGCCTTTCCGGAACCGTCCGCATTCCCGGC GACAAGTCGATCTCCCACCGGTCCTTCA Genbank ID: AY125353.1 |
| Amplicon size: | 108 bp |
| Multiplex method: |
QL-ELE-00-019
|
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | CP4 Synthetic F / | GCATGCTTCACGGTGCAA | 18 bp | CP4-epsps |
| Primer reverse | CP4 Synthetic R / | TGAAGGACCGGTGGGAGAT | 19 bp | CP4-epsps |
| Primer forward | CP4 Synthetic F / | GCATGCTTCACGGTGCAA | 18 bp | CP4-epsps |
| Primer reverse | CP4 synth Rbis / | TGAAGGACCTGTGGGAGAT | 19 bp | CP4-epsps |
