QL-ELE-00-017
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event Bt11 | SYN-BT011-1 (Maize)
GMO event 40-3-2 | MON-04032-6 (Soybean) GMO event RT73 (GT73) | MON-00073-7 (Oilseed Rape) GMO event RF3 | ACS-BN003-6 (Oilseed Rape) GMO event MON810 | MON-00810-6 (Maize) |
| Genetic target: | CaMV P-35S |
| Description: | Qualitative PCR method for detection of CaMV 35S promoter (Barbau-Piednoir et al., 2014) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Element specific |
| Analysis type: | Qualitative |
| Assay: | Real-time PCR (Simplex) |
| Amplicon sequence: |
AAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCC Genbank ID: V00141.1 |
| Amplicon size: | 75 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | 35S_N3Fwd / | AAAGCAAGTGGATTGATGTGATA | 23 bp | CaMV P-35S |
| Primer reverse | 35S_N3Rev / | GGGTCTTGCGAAGGATAGTG | 20 bp | CaMV P-35S |