QL-ELE-00-015
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event RT73 (GT73) | MON-00073-7 (Oilseed Rape)
GMO event MON89788 | MON-89788-1 (Soybean) |
| Genetic target: | P-FMV |
| Description: | Qualitative PCR method for detection of Figwort Mosaic Virus 35S (FMV) promoter (BVL, 2014) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Element specific |
| Analysis type: | Qualitative |
| Assay: | Real-time PCR (Simplex) |
| Amplicon sequence: |
CAAAATAACGTGGAAAAGAGCTGTCCTGACAGCCCACTCACTAATGCGTATGACGAACGCAGTGACGACCACAAAAGA Genbank ID: AR016589 |
| Amplicon size: | 78 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | pFMV-F / | CAAAATAACGTGGAAAAGAGCT | 22 bp | P-FMV |
| Primer reverse | pFMV-R / | TCTTTTGTGGTCGTCACTGC | 20 bp | P-FMV |
| Probe | Probe pFMV / | FAM-CTGACAGCCCACTCACTAATGC-BHQ1 | 22 bp |