European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-ELE-00-006 Element specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward NOS-1 / GAATCCTGTTGCCGGTCTTG 20 bp T-nos
Primer reverse NOS-3 / TTATCCTAGTTTGCGCGCTA 20 bp T-nos

Other methods validated in combination