European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-ELE-00-005 Element specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward 35S-1 / GCTCCTACAAATGCCATCA 19 bp CaMV P-35S
Primer reverse 35S-2 / GATAGTGGGATTGTGCGTCA 20 bp CaMV P-35S

Other methods validated in combination