QL-CON-00-010
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event FP967 | CDC-FL001-2 (Flax)
|
| Genetic target: | DHFR / T-nos |
| Description: | Qualitative PCR method for detection of the junction between the nopaline synthase (nos) terminator and the dihydrofolate reductase gene (DHFR), and for detection of flax event FP967 (EURL GMFF, 2009) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Construct specific |
| Analysis type: | Qualitative |
| Assay: | Real-time PCR (Simplex) |
| Amplicon sequence: |
AGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGATCAAGTAGATACACTACATATATC TACAATAGACATCGAGCCGGAAGGT Genbank ID: OR392454.1 |
| Amplicon size: | 105 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | NOST-Spec Forward primer / NOST-Spec FW | AGCGCGCAAACTAGGATAAA | 20 bp | T-nos |
| Primer reverse | NOST-Spec Reverse primer / NOST-Spec RV | ACCTTCCGGCTCGATGTCTA | 20 bp | DHFR |
| Probe | NOST-Spec Probe / | FAM-CGCGCGCGGTGTCATCTATG-BHQ | 20 bp |
