European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
« Back to search
QL-CON-00-006 Construct specific method icon PDF summary View in GMO-Matrix View in GMO-Amplicons

General information

Method details

Type Name(s) Sequence Length Target
Primer forward p35S-af2 / TGATGTGATATCTCCACTGACG 22 bp CaMV P-35S
Primer reverse petu-ar1 / TGTATCCCTTGAGCCATGTTGT 22 bp CTP

Other methods validated in combination