QL-CON-00-005
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event T25 | ACS-ZM003-2 (Maize)
|
| Genetic target: | pat / CaMV T-35S |
| Description: | Qualitative PCR method for detection of the junction between the pat gene and the CaMV 35S terminator (ISO 21569:2005) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Construct specific |
| Analysis type: | Qualitative |
| Assay: | PCR (Simplex) |
| Amplicon sequence: |
ATGGTGGATGGCATGATGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTCTTATAGGGTTTCGCTCA |
| Amplicon size: | 210 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | T25-F7 / | ATGGTGGATGGCATGATGTTG | 21 bp | pat |
| Primer reverse | T25-R3 / | TGAGCGAAACCCTATAAGAACCC | 23 bp | CaMV T-35S |
