QL-CON-00-004
|
View in GMO-Matrix | View in GMO-Amplicons |
General information
| Tested in: |
GMO event Bt176 (176) | SYN-EV176-9 (Maize)
|
| Genetic target: | P-CDPK / Cry1A(b) |
| Description: | Qualitative PCR method for detection of the junction between the CDPK promoter from maize and the synthetic Cry1A(b) gene (ISO 21569:2005) |
| Comments: | Element-specific and construct-specific methods may generate amplicons with different sequence or length depending on the GMO events where the element or construct is found. |
Method details
| Specificity: | Construct specific |
| Analysis type: | Qualitative |
| Assay: | Endpoint PCR (Simplex) |
| Amplicon sequence: |
CTCTCGCCGTTCATGTCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCAGCCTGAGCCTGACC |
| Amplicon size: | 212 bp |
| Oligos: |
| Type | Name(s) | Sequence | Length | Target |
|---|---|---|---|---|
| Primer forward | Cry03 / | CTCTCGCCGTTCATGTCCGT | 20 bp | P-CDPK |
| Primer reverse | Cry04 / | GGTCAGGCTCAGGCTGATGT | 20 bp | Cry1A(b) |
