Only one hit for query 'ac:CDC-FL001-2'
ID QL-CON-00-010; SV 0; linear; genomic DNA; STS; SYN; 105 BP. XX AC CDC-FL001-2; XX DT 27-NOV-2012 DT 01-DEC-2016 XX DE Qualitative PCR method for detection of flax event FP967 XX KW construct_specific. XX OS Linum usitatissimum (flax) - event FP967 (CDC-FL001-2) XX RN [1] RP 1-105 RA Grohmann L., Busch U., Pecoraro S., Hess N., Pietsch K., Mankertz J.; RT "Collaborative trial validation of a construct-specific real-time PCR RT method for detection of genetically modified linseed event 'CDC Triffid' RT FP967"; RL Eur Food Res Technol 232:557-561 (2011). RX DOI=10.1007/s00217-010-1403-7 XX RN [2] RP 1-105 RT "Horizontal methods for molecular biomarker analysis - Methods of analysis for the detection of genetically modified organisms and derived products - Part 2: Construct-specific real-time PCR method for detection of event FP967 in linseed and linseed products"; RL ISO/TS 21569-2:1-9 (2012). RX ISO=60166 XX RN [3] RP 1-105 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Report on the Verification of the Performance of a Construct-Specific Assay for the Detection of Flax CDC Triffid Event FP967 Using Real-Time PCR"; RL Online Publication (2009). RX CRL-DOC=Flax-CDCTriffidFlaxJRC091030.pdf RX CRL-DOC=Flax_FP967_verification_report.pdf XX RN [4] RP 1-105 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2012). RX PCR=QL-CON-00-010.pdf XX DR GMOMETHODS; QL-TAX-LU-001; XX FH Key Location/Qualifiers FH FT STS 1..105 FT /standard_name="PCR 105 bp amplicon" FT /note="construct-specific RT-PCR" FT /target="Junction region between the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens and the dihydrofolate reductase (dhfr) gene from Escherichia coli"; FT primer_bind 1..20 FT /standard_name="Primer forward: NOST-Spec FW" FT /note="AGCGCGCAAACTAGGATAAA" FT /target="T-nos" FT primer_bind 25..44 FT /standard_name="RT-PCR probe: NOST-Spec Probe" FT /note="FAM-CGCGCGCGGTGTCATCTATG-BHQ" FT primer_bind complement(86..105) FT /standard_name="Primer reverse: NOST-Spec RV" FT /note="ACCTTCCGGCTCGATGTCTA" FT /target="dhfr" XX SQ Sequence 105 BP; 35 A; 22 C; 23 G; 25 T; 0 other; agcgcgcaaa ctaggataaa nnnncgcgcg cggtgtcatc tatgnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnntagac atcgagccgg aaggt 105 //