ID QT-EVE-BN-010; SV 0; linear; genomic DNA; STS; SYN; 101 BP. XX AC MON-88302-9; XX DT 13-SEP-2011 DT 03-DEC-2013 XX DE Quantitative PCR method for detection of oilseed rape event MON88302 (Savini et al., 2013). XX KW event_specific. XX OS Brassica napus (oilseed rape)- event MON88302 (MON-88302-9) XX RN [1] RP 1-101 RA Savini C., et al.; RT "Event-specific Method for the Quantification of Oilseed Rape MON88302 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2013). RX EURL_GMFF=EURL-VL-09-11-VR-MON88302.pdf RX EURL_GMFF=EURL-VL-09-11-VM-MON88302.pdf XX RN [2] RP 1-101 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2013). RX PCR=QT-EVE-BN-010.pdf XX DR GMOMETHODS; QT-TAX-BN-002; XX FH Key Location/Qualifiers FH FT STS 1..101 FT /standard_name="PCR 101 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="5' integration border region (IBR) between the insert of oilseed rape event MON88302 and the oilseed rape host genome" FT primer_bind 1..27 FT /standard_name="Primer forward: 88302QF" FT /note="TCCTTGAACCTTATTTTATAGTGCACA" FT /target="5'-host genome" FT primer_bind 36..65 FT /standard_name="RT-PCR probe: 88302QP" FT /note="FAM-TAGTCATCATGTTGTACCACTTCAAACACT-TAMRA" FT primer_bind complement(78..101) FT /standard_name="Primer reverse: 88302QR" FT /note="TCAGATTGTCGTTTCCCGCCTTCA" FT /target="insert" XX SQ Sequence 101 BP; 33 A; 21 C; 16 G; 31 T; 0 other; tccttgaacc ttattttata gtgcacannn nnnnntagtc atcatgttgt accacttcaa 60 acactnnnnn nnnnnnntga aggcgggaaa cgacaatctg a 101 //