An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-89788-1'
ID   QT-EVE-GM-006; SV 0; linear; genomic DNA; STS; SYN; 139 BP.
XX
AC   MON-89788-1;
XX
DT   17-AUG-2009
DT   17-NOV-2010
XX
DE   Quantitative PCR method for detection of soybean event MON89788
DE   (Charles Delobel et al., 2008).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event MON89788 (MON-89788-1)
XX
RN   [1]
RP   1-139
RA   Charles Delobel C., Bogni A., Pinski G., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Soybean Line MON 89788 - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/44579 
XX
RN   [2]
RP   1-139
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GM-006.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..139
FT                   /standard_name="PCR 139 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of soybean event MON 89788 and the soybean host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: MON89788-F"
FT                   /note="TCCCGCTCTAGCGCTTCAAT"
FT                   /target="5'-host genome"
FT   primer_bind     56..79
FT                   /standard_name="RT-PCR probe: MON89788-P"
FT                   /note="FAM-CTGAAGGCGGGAAACGACAATCTG-TAMRA"
FT   primer_bind     complement(121..139)
FT                   /standard_name="Primer reverse: MON89788-R"
FT                   /note="TCGAGCAGGACCTGCAGAA"
FT                   /target="insert"
XX
SQ   Sequence 139 BP; 13 A; 19 C; 16 G; 15 T; 76 other;
     tcccgctcta gcgcttcaat nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnctgaa        60
     ggcgggaaac gacaatctgn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     ttctgcaggt cctgctcga                                                    139
//