Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-89788-1'
ID   QT-TAX-GM-020; SV 0; linear; genomic DNA; STD; PLN; 102 BP.
XX
AC   ;
XX
DT   06-JUN-2008
DT   20-AGO-2012
XX
DE   Quantitative PCR method for detection of soybean lectin gene
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Glycine max (soybean)
XX
RN   [1]
RP   1-102
RA   Charles Delobel C., Bogni A., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Soybean Line A5547-127 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2009).
RX   DOI=10.2788/60083
XX
RN   [2]
RP   1-102
RA   Savini C.,;
RT   "Event-specific Method for the Quantification of Soybean FG72 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2012).
RX   EURL_GMFF=EURL-VL-04 10 VR.pdf
RX   EURL_GMFF=EURL-VL-04-10 VP.pdf
XX
RN   [3]
RP   1-102
RT   "See Cross-references below";
RL   Online Publication (2012).
XX
DR   GMOMETHODS; QT-EVE-GM-007;
DR   GMOMETHODS; QT-EVE-GM-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..102
FT                   /standard_name="PCR 102 bp amplicon"
FT                   /note="taxon-specific RT-PCR for soybean"
FT                   /target="lectin (Le1) gene"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: KVM164"
FT                   /note="CTTTCTCGCACCAATTGACA"
FT                   /target="Le1"
FT   primer_bind     26..51
FT                   /standard_name="RT-PCR probe: TM021"
FT                   /note="VIC-CCACAAACACATGCAGGTTATCTTGG-TAMRA"
FT   primer_bind     complement(83..102)
FT                   /standard_name="Primer reverse: KVM165"
FT                   /note="TCAAACTCAACAGCGACGAC"
FT                   /target="Le1"
XX
SQ   Sequence 102 BP; 15 A; 17 C; 14 G; 20 T; 36 other;
     ctttctcgca ccaattgaca nnnnnccaca aacacatgca ggttatcttg gnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nngtcgtcgc tgttgagttt ga                          102
//