European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:MON-89788-1'
ID   QT-EVE-GM-006; SV 0; linear; genomic DNA; STS; SYN; 139 BP.
XX
AC   MON-89788-1;
XX
DT   17-AUG-2009
DT   17-NOV-2010
XX
DE   Quantitative PCR method for detection of soybean event MON89788
DE   (Charles Delobel et al., 2008).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event MON89788 (MON-89788-1)
XX
RN   [1]
RP   1-139
RA   Charles Delobel C., Bogni A., Pinski G., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Soybean Line MON 89788 - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/44579 
XX
RN   [2]
RP   1-139
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GM-006.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..139
FT                   /standard_name="PCR 139 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of soybean event MON 89788 and the soybean host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: MON89788-F"
FT                   /note="TCCCGCTCTAGCGCTTCAAT"
FT                   /target="5'-host genome"
FT   primer_bind     56..79
FT                   /standard_name="RT-PCR probe: MON89788-P"
FT                   /note="FAM-CTGAAGGCGGGAAACGACAATCTG-TAMRA"
FT   primer_bind     complement(121..139)
FT                   /standard_name="Primer reverse: MON89788-R"
FT                   /note="TCGAGCAGGACCTGCAGAA"
FT                   /target="insert"
XX
SQ   Sequence 139 BP; 13 A; 19 C; 16 G; 15 T; 76 other;
     tcccgctcta gcgcttcaat nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnctgaa        60
     ggcgggaaac gacaatctgn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     ttctgcaggt cctgctcga                                                    139
//