An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:ql-ele*&ft:cry1a(b)*'
ID   QL-ELE-00-020; SV 1; linear; other DNA; STD; UNA; 73 BP.
XX
AC   ;
XX
DT   07-JAN-2010
DT   29-FEB-2016
XX
DE   Qualitative PCR method for detection of cry1A(b) gene (Barbau-Piednoir et al., 2014).
XX
KW   element_specific.
XX
RN   [1]
RP   1-73
RA   Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G.,
RA   Van den Bulcke M.;
RT   "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR
RT   Screening(CoSYPS)";
RL   Food Analitical Methods 0:0-0 (2014).
RX   DOI=10.1007/s12161-014-9837-3
XX
RN   [2]
RP   1-73
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2014).
RX   PCR=QL-ELE-00-020.pdf
XX
DR   GMOMETHODS; QL-TAX-BN-003;
DR   GMOMETHODS; QL-TAX-GM-001;
DR   GMOMETHODS; QL-TAX-ZM-002;
DR   GMOMETHODS; QL-PLN-00-006;
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    1..73
FT                   /note="Sybricon020 insert containing partial Bacillus
FT                   thuringiensis Cry1A(b) gene isolated from Zea mays MON810"
FT   STS             1..73
FT                   /standard_name="PCR 73 bp amplicon"
FT                   /note="element-specific PCR"
FT                   /target="cry1A(b) synthetic construct derived from Bacillus thuringiensis"
FT   primer_bind     1..19
FT                   /standard_name="Primer reverse: Cry1Ab_Bt_Cott_Rev"
FT                   /note="CAGCACCTGGCACGAACTC"
FT                   /target="cry1A(b)"
FT   primer_bind     complement(54..73)
FT                   /standard_name="Primer forward: Cry1Ab_Bt_Cott_Fwd"
FT                   /note="ACCGGTTACACTCCCATCGA"
FT                   /target="cry1A(b)"
XX
SQ   Sequence 73 BP; 18 A; 15 C; 29 G; 11 T; 0 other;
     cagcacctgg cacgaactcn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnntcgatgg        60
     gagtgtaacc ggt                                                           73
//