An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-GH-015; SV 0; linear; mRNA; STS; PLN; 76 BP.
XX
AC   ;
XX
DT   25-JUN-2008
DT   12-JUL-2016
XX
DE   Quantitative PCR method for detection of cotton fiber-specific acyl carrier protein gene
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Gossypium hirsutum (upland cotton)
XX
RN   [1]
RP   1-76
RA   Mazzara M., Bogni A., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line MON1445 Using Real-time PCR Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/4455
XX
RN   [2]
RP   1-76
RA   Savini C., Mazzara M., Munaro B., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line MON 15985 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/4378
XX
RN   [3]
RP   1-76
RA   Mazzara M., Bogni A., Foti N., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43936
XX
RN   [4]
RP   1-76
RA   Charles Delobel C., Luque Perez E., Pinski G., Bogni A., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton MON 88913 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2009).
RX   DOI=10.2788/58818
XX
RN   [5]
RP   1-76
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Cotton MON88701 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RX   EURL_GMFF=EURL-VL-01-13-VR.pdf
RX   EURL_GMFF=MON-88701-Validated-Method.pdf
XX
RN   [6]
RP   1-76
RT   "See Cross-references below";
RL   Online Publication (2010).
XX
DR   GMOMETHODS; QT-EVE-GH-003;
DR   GMOMETHODS; QT-EVE-GH-005;
DR   GMOMETHODS; QT-EVE-GH-004;
DR   GMOMETHODS; QT-EVE-GH-007;
DR   GMOMETHODS; QT-EVE-GH-010;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..76
FT                   /standard_name="PCR 76 bp amplicon"
FT                   /note="taxon-specific RT-PCR for cotton"
FT                   /target="fiber-specific acyl carrier protein (ACP1)"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: "
FT                   /note="ATTGTGATGGGACTTGAGGAAGA~One mismatch found: 331st
FT                   nucleotide, based on the sequence coming from EMBL record
FT                   with accession number U48777, is T. 7th nucleotide, based
FT                   on CRL dossier concerning GMO event MON1445, MON15985 and
FT                   MON531, is A."
FT                   /target="ACP1"
FT   primer_bind     complement(25..51)
FT                   /standard_name="RT-PCR probe: "
FT                   /note="FAM-ATTGTCCTCTTCCACCGTGATTCCGAA-TAMRA. ~One mismatch found:
FT                   375th nucleotide, based on the sequence coming from EMBL
FT                   record with accession number U48777, is C. 1st
FT                   nucleotide, based on CRL dossier concerning GMO event
FT                   MON1445, MON15985 and MON531, is A."
FT   primer_bind     complement(53..76)
FT                   /standard_name="Primer reverse: "
FT                   /note="CTTGAACAGTTGTGATGGATTGTG"
FT                   /target="ACP1"
XX
SQ   Sequence 76 BP; 24 A; 14 C; 20 G; 16 T; 2 other;
     attgtgttgg gacttgagga aganttcgga atcacggtgg aagaggacaa cncacaatcc        60
     atcacaactg ttcaag                                                        76
//