ID QT-EVE-BN-001; SV 0; linear; genomic DNA; STS; SYN; 123 BP. XX AC ACS-BN008-2; XX DT 21-FEB-2006 DT 08-NOV-2010 XX DE Quantitative PCR method for detection of oilseed rape event T45 DE (Charles Delobel et al., 2006). XX KW event_specific. XX OS Brassica napus (oilseed rape) - event T45 (ACS-BN008-2) XX RN [1] RP 1-123 RA Charles Delobel C., Bogni A., Mazzara M., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Oilseed Rape Line T45 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Oilseed Rape"; RL Online Publication (2006). RX DOI=10.2788/30936 XX RN [2] RP 1-123 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-BN-001.pdf XX DR GMOMETHODS; QT-TAX-BN-012; XX FH Key Location/Qualifiers FH FT STS 1..123 FT /standard_name="PCR 123 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of oilseed rape event T45 and the oilseed rape host genome" FT primer_bind 1..21 FT /standard_name="Primer forward: KVM172" FT /note="CAATGGACACATGAATTATGC" FT /target="5'-host genome" FT primer_bind 70..94 FT /standard_name="RT-PCR probe: TM026 probe" FT /note="FAM-TAGAGGACCTAACAGAACTCGCCGT-TAMRA" FT primer_bind complement(103..123) FT /standard_name="Primer reverse: MDB599" FT /note="GACTCTGTATGAACTGTTCGC" FT /target="insert" XX SQ Sequence 123 BP; 47 A; 23 C; 26 G; 27 T; 0 other; caatggacac atgaattatg cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnt agaggaccta acagaactcg ccgtnnnnnn nngcgaacag ttcatacaga 120 gtc 123 //