An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-EVE-ZM-012; SV 0; linear; genomic DNA; STS; SYN; 86 BP.
AC   DAS-59122-7;
DT   12-JAN-2006
DT   13-OCT-2010
DE   Quantitative PCR  method for detection of maize event 59122
DE   (Mazzara et al., 2006).
KW   event_specific.
OS   Zea mays (maize) - event 59122 (DAS-59122-7)
RN   [1]
RP   1-86
RA   Mazzara M., Grazioli E., Larcher S., Savini C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol";
RL   Online Publication (2006).
RX   DOI=10.2788/31820
RN   [2]
RP   1-86
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-012.pdf
FH   Key             Location/Qualifiers
FT   STS             1..86
FT                   /standard_name="PCR 86 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="Integration border region (IBR) between the insert of maize event 59122 and the maize host genome"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: DAS-59122-7-rb1f"
FT                   /note="GGGATAAGCAAGTAAAAGCGCTC"
FT                   /target="not specified"
FT   primer_bind     36..61
FT                   /standard_name="RT-PCR probe: DAS-59122-7-rb1s"
FT   primer_bind     complement(63..86)
FT                   /standard_name="Primer reverse: DAS-59122-rb1r"
FT                   /note="CCTTAATTCTCCGCTCATGATCAG"
FT                   /target="not specified"
SQ   Sequence 86 BP; 28 A; 11 C; 22 G; 12 T; 13 other;
     gggataagca agtaaaagcg ctcnnnnnnn nnnnntttaa actgaaggcg ggaaacgaca        60
     anctgatcat gagcggagaa ttaagg                                             86