An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DP-073496-4'
ID   QT-EVE-BN-009; SV 0; linear; genomic DNA; STS; SYN; 84 BP.
XX
AC   DP-073496-4;
XX
DT   29-JUN-2012
DT   09-MAY-2015
XX
DE   Quantitative PCR method for detection of oilseed rape event 73496
DE   (Jacchia et al., 2014).
XX
KW   event_specific.
XX
OS   Brassica napus (oilseed rape) - event 73496 (DP-073496-4)
XX
RN   [1]
RP   1-84
RA   Jacchia S., Bogni A., Mazzara M., Kreysa J.;
RT   "Event-specific Method for the Quantification of Oilseed Rape DP-073496-4 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction from Oilseed Rape";
RL   Online Publication (2014).
RX   EURL_GMFF=EURL-VL-02-12VR-EFSA-Corr1.pdf
RX   EURL_GMFF=EURL-VL-02-12VP-EFSA-Corr1.pdf
XX
RN   [2]
RP   1-84
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2014).
RX   PCR=QT-EVE-BN-009.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..84
FT                   /standard_name="PCR 84 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region (IBR) between the insert of oilseed rape event 73496 and the oilseed rape host genome"
FT   primer_bind     1..30
FT                   /standard_name="Primer forward: 09-0-2824"
FT                   /note="GTTCTTCTCTTCATAGCTCATTACAGTTTT"
FT                   /target="5'-host genome"
FT   primer_bind     33..55
FT                   /standard_name="RT-PCR probe: 09-QP-83"
FT                   /note="FAM-TTAGTTAGATCAGGATATTCTTG-MGBNFQ"
FT   primer_bind     complement(57..84)
FT                   /standard_name="Primer reverse: 09-0-2825"
FT                   /note="CAAACCTCCATAGAGTTCAACATCTTAA"
FT                   /target="insert"
XX
SQ   Sequence 84 BP; 19 A; 12 C; 16 G; 37 T; 0 other;
     gttcttctct tcatagctca ttacagtttt nnttagttag atcaggatat tcttgnttaa        60
     gatgttgaac tctatggagg tttg                                               84
//