Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-ZM-035; SV 0; linear; genomic DNA; STD; SYN; 75 BP.
XX
AC   DP-023211-2;
XX
DT   15-FEB-2024
DT   15-FEB-2024
XX
DE   Quantitative PCR method for detection of maize event DP23211 (EURL GMFF, 2023).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event DP23211 (DP-023211-2) 
XX
RN   [1]
RP   1-75
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize DP23211 Using
RT   Real-time PCR - Validation Report";
RL   Online Publication (2023).
RX   EURL_GMFF=EURL-VL-09-19-VR.pdf
RX   EURL_GMFF=EURL-VL-09-19-VM.pdf
XX
RN   [2]
RP   1-75
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2023).
RX   PCR=QT-EVE-ZM-035.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-008;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..75
FT                   /standard_name="PCR 75 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event DP23211 and the maize host genome"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: PHN175787_f"
FT                   /note="TTACGGCATCTAGGACCGACTAG"
FT                   /target="insert"
FT   primer_bind     32..50
FT                   /standard_name="RT-PCR probe: PHN175789_p"
FT                   /note="FAM-CTAGTACGTAGTGAATCTG_MGBNFQ"
FT   primer_bind     complement(52..75)
FT                   /standard_name="Primer reverse: PHN175788_r"
FT                   /note="GAAGCACTTGTTTTTCAATTCCAA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 75 BP; 24 A; 14 C; 16 G; 21 T; 0 other;
     ttacggcatc taggaccgac tagnnnnnnn nctagtacgt agtgaatctg nttggaattg        60
     aaaaacaagt gcttc                                                         75
//