ID QT-ELE-00-001; SV 0; linear; genomic DNA; STS; SYN; 79 BP. XX AC ; XX DT 25-MAY-2009 DT 30-SEP-2010 XX DE Quantitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter DE (Feinberg et al., 2005). XX KW element_specific. XX RN [1] RP 1-79 RA Feinberg M., Fernandez S., Cassard S., Bertheau Y.; RT "Quantitation of 35S promoter in maize DNA extracts from genetically RT modified organisms using real-time polymerase chain reaction, part 2: RT interlaboratory study"; RL J AOAC Int 88:558-573 (2005). RX PUBMED; 15859084. XX RN [2] RP 1-79 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-ELE-00-001.pdf XX FH Key Location/Qualifiers FH FT STS 1..79 FT /standard_name="PCR 79 bp amplicon" FT /note="element-specific RT-PCR" FT /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)" FT primer_bind 1..22 FT /standard_name="Primer forward: sF" FT /note="CGTCTTCAAAGCAAGTGGATTG" FT /target="CaMV P-35S" FT primer_bind 31..56 FT /standard_name="RT-PCR probe: 35S core" FT /note="FAM-TCTCCACTGACGTAAGGGATGACGCA-TAMRA" FT primer_bind complement(58..79) FT /standard_name="Primer reverse: sR" FT /note="TCTTGCGAAGGATAGTGGGATT" FT /target="CaMV P-35S" XX SQ Sequence 79 BP; 23 A; 20 C; 17 G; 19 T; 0 other; cgtcttcaaa gcaagtggat tgnnnnnnnn tctccactga cgtaagggat gacgcanaat 60 cccactatcc ttcgcaaga 79 //