ID QT-CON-00-008; SV 0; linear; genomic DNA; STS; SYN; 133 BP. XX AC MON-00021-9; XX DT 15-SEP-2009 DT 05-OCT-2016 XX DE Quantitative PCR method for detection of the junction between an optimized transit peptide sequence and the point mutated epsps gene from maize. XX KW construct_specific. XX OS Zea mays (maize) - event GA21 (MON-00021-9) XX RN [1] RP 1-133 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-133 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-133 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-008.pdf XX DR GMOMETHODS; QT-TAX-ZM-006; XX FH Key Location/Qualifiers FH FT STS 1..133 FT /standard_name="PCR 133 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between an optimized transit peptide sequence (OTP) and point mutated epsps gene (mEPSPS) from maize" FT primer_bind 1..18 FT /standard_name="Primer forward: GA21 3-5'" FT /note="GAAGCCTCGGCAACGTCA" FT /target="OTP" FT primer_bind 29..48 FT /standard_name="RT-PCR probe: GA21-2-Taq" FT /note="FAM-AAGGATCCGGTGCATGGCCG-TAMRA" FT primer_bind complement(114..133) FT /standard_name="Primer reverse: GA21 3-3'" FT /note="ATCCGGTTGGAAAGCGACTT" FT /target="mEPSPS" XX SQ Sequence 133 BP; 28 A; 42 C; 44 G; 19 T; 0 other; gaagcctcgg caacgtcann nnnnnnnnaa ggatccggtg catggccgnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnaagtcgc 120 tttccaaccg gat 133 //