ID QT-CON-00-007; SV 0; linear; genomic DNA; STS; SYN; 100 BP. XX AC SYN-EV176-9; XX DT 15-SEP-2009 DT 05-OCT-2016 XX DE Quantitative PCR method for detection of the junction between a synthetic cry1A(b) gene and the Phospho-enol-pyruvate Carboxylase intron N.9. XX KW construct_specific. XX OS Zea mays (maize) - event Bt176 (SYN-EV176-9) XX RN [1] RP 1-100 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-100 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-100 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-007.pdf XX DR GMOMETHODS; QT-TAX-ZM-006; XX FH Key Location/Qualifiers FH FT STS 1..100 FT /standard_name="PCR 100 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between a synthetic cry1A(b) gene and the Phospho-enol-pyruvate Carboxylase (PEPC) intron N.9" FT primer_bind 1..20 FT /standard_name="Primer forward: E176 2-5'" FT /note="TGTTCACCAGCAGCAACCAG" FT /target="cry1A(b)" FT primer_bind 34..58 FT /standard_name="RT-PCR probe: E176-Taq" FT /note="FAM-CCGACGTGACCGACTACCACATCGA-TAMRA" FT primer_bind complement(76..100) FT /standard_name="Primer reverse: E176 2-3'" FT /note="ACTCCACTTTGTGCAGAACAGATCT" FT /target="IVS 9 PEPC" XX SQ Sequence 100 BP; 27 A; 27 C; 26 G; 20 T; 0 other; tgttcaccag cagcaaccag nnnnnnnnnn nnnccgacgt gaccgactac cacatcgann 60 nnnnnnnnnn nnnnnagatc tgttctgcac aaagtggagt 100 //