An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-ELE-00-001; SV 0; linear; genomic DNA; STS; SYN; 79 BP.
XX
AC   ;
XX
DT   25-MAY-2009
DT   30-SEP-2010
XX
DE   Quantitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter
DE   (Feinberg et al., 2005).
XX
KW   element_specific.
XX
RN   [1]
RP   1-79
RA   Feinberg M., Fernandez S., Cassard S., Bertheau Y.;
RT   "Quantitation of 35S promoter in maize DNA extracts from genetically
RT   modified organisms using real-time polymerase chain reaction, part 2:
RT   interlaboratory study";
RL   J AOAC Int 88:558-573 (2005).
RX   PUBMED; 15859084.
XX
RN   [2]
RP   1-79
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-ELE-00-001.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..79
FT                   /standard_name="PCR 79 bp amplicon"
FT                   /note="element-specific RT-PCR"
FT                   /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: sF"
FT                   /note="CGTCTTCAAAGCAAGTGGATTG"
FT                   /target="CaMV P-35S"
FT   primer_bind     23..57
FT                   /standard_name="RT-PCR probe: 35S core"
FT                   /note="FAM-TCTCCACTGACGTAAGGGATGACGCA-TAMRA"
FT   primer_bind     complement(58..79)
FT                   /standard_name="Primer reverse: sR"
FT                   /note="TCTTGCGAAGGATAGTGGGATT"
FT                   /target="CaMV P-35S"
XX
SQ   Sequence 79 BP; 13 A; 12 C; 8 G; 11 T; 35 other;
     cgtcttcaaa gcaagtggat tgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnaat        60
     cccactatcc ttcgcaaga                                                     79
//