Only one hit for query 'id%3aQT-eve-CP*'
ID QT-EVE-BN-007; SV 0; linear; genomic DNA; STS; SYN; 104 BP. XX AC ACS-BN002-5; XX DT 22-NOV-2011 DT 14-FEB-2008 XX DE Quantitative PCR method for detection of oilseed rape event Rf2 (verified by the EU-RL GMFF in the context of Commission Decision 2007/306/EC) XX KW event_specific, EU-RL_GMFF_in-house_verified. XX OS Brassica napus (oilseed rape) - event RF2 (ACS-BN002-5) XX RN [1] RP 1-104 RA Mazzara M.,; RT "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF2 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=Rf2 Validation Report.pdf RX EURL_GMFF=Rf2 Validated Method Protocol CRL-VL-1004.pdf XX RN [2] RP 1-104 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2011). RX PCR=QT-EVE-BN-007.pdf XX DR GMOMETHODS; QT-TAX-BN-012; XX FH Key Location/Qualifiers FH FT STS 1..104 FT /standard_name="PCR 104 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5'integration border region (IBR) between the insert of oilseed rape event RF2 and the oilseed rape host genome"; FT primer_bind 1..21 FT /standard_name="Primer forward: MDB207" FT /note="GGGTGAGACAATATATCGACG" FT /target="5'-host genome" FT primer_bind 52..77 FT /standard_name="RT-PCR probe: TM024" FT /note="FAM-CACCGGCCAAATTCGCTCTTAGCCGT-TAMRA" FT primer_bind complement(87..104) FT /standard_name="Primer reverse: KVM171" FT /note="GGGCATCGCACCGGTGAG" FT /target="insert" XX SQ Sequence 104 BP; 29 A; 27 C; 21 G; 27 T; 0 other; gggtgagaca atatatcgac gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ncaccggcca 60 aattcgctct tagccgtnnn nnnnnnctca ccggtgcgat gccc 104 //