ID QT-CON-00-004; SV 0; linear; genomic DNA; STS; SYN; 113 BP. XX AC MON-00810-6; XX DT 15-SEP-2009 DT 05-OCT-2016 XX DE Quantitative PCR method for detection of the junction between the intron 1 from the maize hsp70 gene and a DE synthetic cry1A(b) gene. XX KW construct_specific. XX OS Zea mays (maize) - event MON810 (MON-00810-6) XX RN [1] RP 1-113 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-113 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-113 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-004.pdf XX DR GMOMETHODS; QT-TAX-ZM-006; XX FH Key Location/Qualifiers FH FT STS 1..113 FT /standard_name="PCR 113 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the Intron 1 from the maize hsp70 gene (IVS-HSP) and a synthetic cry1A(b) gene" FT primer_bind 1..22 FT /standard_name="Primer forward: M810 2-5'" FT /note="GATGCCTTCTCCCTAGTGTTGA" FT /target="IVS 1 hsp70" FT primer_bind 65..90 FT /standard_name="RT-PCR probe: M810-Taq" FT /note="FAM-AGATACCAAGCGGCCATGGACAACAA-TAMRA" FT primer_bind complement(93..113) FT /standard_name="Primer reverse: M810 2-3'" FT /note="GGATGCACTCGTTGATGTTTG" FT /target="cry1A(b)" XX SQ Sequence 113 BP; 31 A; 32 C; 20 G; 30 T; 0 other; gatgccttct ccctagtgtt gannnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnagatac caagcggcca tggacaacaa nncaaacatc aacgagtgca tcc 113 //