An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:QT-eve-CP*'
ID   QT-EVE-CP-001; SV 0; linear; genomic DNA; STD; SYN; 175 BP.
XX
AC   ;
XX
DT   26-JUN-2013
DT   01-DEC-2016
XX
DE   Quantitative PCR method for detection of papaya event Huanong N 1 (Wei et al., 2016).
XX
KW   event_specific.
XX
OS   Carica papaya (papaya) - event Huanong No. 1
XX
RN   [1]
RP   1-175
RA   Wei J., Le H., Pan A., Xu J., Li F., Li X., Quan S., Guo J., Yang L.;
RT   "Collaborative trial for the validation of event-specific PCR detection methods of genetically modified papaya Huanong No. 1";
RL   Food Chemistry 194:20-25 (2016).
RX   DOI=10.1016/j.foodchem.2015.07.010.
XX
RN   [2]
RP   1-175
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QT-EVE-CP-001.pdf
XX
DR   GMOMETHODS; QT-TAX-CP-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..175
FT                   /standard_name="PCR 175 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region (IBR) between the insert of papaya event Huanong No 1 and the papaya host genome";
FT   misc_feature    1..133
FT                   /note="Papaya genomic sequence, 5' flanking region"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: qHN-F"
FT                   /note="GACGAGTACAAGGAGACGCC"
FT                   /target="5'-host genome"
FT   primer_bind     complement(126..151)
FT                   /standard_name="RT-PCR probe: qHN-P"
FT                   /note="FAM-TGGCTGCTATTGGGCGAATCAACTAC-BHQ1"
FT   misc_feature    complement(134..175)
FT                   /note="nptII fragment"
FT   primer_bind     complement(156..175)
FT                   /standard_name="Primer reverse: qHN-R"
FT                   /note="GTTGTCACTGAAGCGGGAAG"
FT                   /target="insert"
XX
SQ   Sequence 175 BP; 67 A; 31 C; 22 G; 55 T; 0 other;
     gacgagtaca aggagacgcc ttttaatttg tttaaattaa ataaaaacat aaattattaa        60
     gcgacgtaat aataaacacg tcataaattt tttcaaaaaa taaaatttct tttattttct       120
     aaaaagtagt tgattcgccc aatagcagcc agtcccttcc cgcttcagtg acaac            175
//