Only one hit for query 'ac:MON-88701-3'
ID QT-CON-00-003; SV 0; linear; genomic DNA; STS; SYN; 74 BP. XX AC MON-04032-6; XX DT 29-MAY-2009 DT 06-OCT-2016 XX DE Quantitative PCR method for detection of the junction between the CaMV35S promoter and the CTP sequence (ISO/FDIS 21570:2005). XX KW construct_specific. XX OS Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6) XX RN [1] RP 1-74 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [2] RP 1-74 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-003.pdf XX DR GMOMETHODS; QT-TAX-GM-002; XX FH Key Location/Qualifiers FH FT STS 1..74 FT /standard_name="PCR 74 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene" FT primer_bind 1..21 FT /standard_name="Primer forward: RR1-F" FT /note="CATTTGGAGAGGACACGCTGA" FT /target="CaMV P-35S" FT primer_bind 22..45 FT /standard_name="RT-PCR probe: RR1" FT /note="FAM-CAAGCTGACTCTAGCAGATCTTTC-TAMRA" FT primer_bind complement(52..74) FT /standard_name="Primer reverse: RR1-R" FT /note="GAGCCATGTTGTTAATTTGTGCC" FT /target="CTP4" XX SQ Sequence 74 BP; 26 A; 17 C; 16 G; 15 T; 0 other; catttggaga ggacacgctg acaagctgac tctagcagat ctttcnnnnn nggcacaaat 60 taacaacatg gcac 74 //