ID QL-CON-00-009; SV 0; linear; genomic DNA; STS; SYN; 83 BP. XX AC ; XX DT 04-AUG-2009 DT 06-OCT-2016 XX DE Qualitative PCR method for detection of the junction between cry1A(b)/cry1A(c) and DNA spacer sequences in the context of Commission Decision 2008/289/EC) XX KW construct_specific, EU-RL_GMFF_in-house_verified. XX OS Oryza sativa (rice) - event Bt63 XX RN [1] RP 1-83 RA Savini C., Querci M., Ermolli M., Mazzara M., Cordeil S., Van den Eede RA G.; RT "Report on the Verification of the Performance of a Method for the RT Detection of 'Bt63' Rice Using Real-Time PCR"; RL Online Publication (2008). RX CRL=Bt63_Rice_verification_report_final.pdf XX RN [2] RP 1-83 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-009.pdf XX DR GMOMETHODS; QL-TAX-OS-003; XX FH Key Location/Qualifiers FH FT STS 1..83 FT /standard_name="PCR 83 bp amplicon" FT /note="construct-specific RT-PCR" FT /target="Junction region between the cry1A(b)/cry1A(c) fusion gene and the DNA spacer sequences linking the fusion gene to the nopaline synthase terminator (T-nos)" FT primer_bind 1..25 FT /standard_name="Primer forward: T51F" FT /note="GACTGCTGGAGTGATTATCGACAGA" FT /target="cry1Ac" FT primer_bind 27..58 FT /standard_name="RT-PCR probe: T51p" FT /note="FAM-TCGAGTTCATTCCAGTTACTGCAACACTCGAG-TAMRA" FT primer_bind complement(60..83) FT /standard_name="Primer reverse: T51R" FT /note="AGCTCGGTACCTCGACTTATTCAG" FT /target="DNA spacer sequences" XX SQ Sequence 83 BP; 22 A; 18 C; 22 G; 21 T; 0 other; gactgctgga gtgattatcg acagantcga gttcattcca gttactgcaa cactcgagnc 60 tgaataagtc gaggtaccga gct 83 //