An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-GH-019; SV 0; linear; genomic DNA; STS; PLN; 73 BP.
XX
AC   ;
XX
DT   30-JUN-2008
DT   25-JAN-2013
XX
DE   Quantitative PCR method for detection of cotton alcohol dehydrogenase C gene
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Gossypium hirsutum (upland cotton)
XX
RN   [1]
RP   1-73
RA   Savini C., Bogni A., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line GHB614 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43697
XX
RN   [2]
RP   1-73
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-Specific Method for the Quantification of Cotton GHB119 Using Real-time PCR - Validation Report - Corrected version 1";
RL   Online Publication (2012).
RX   EURL_GMFF=2012-10-11 EURL VL0411 VR.pdf
RX   EURL_GMFF=2012-10-11 EURL VL0411 VP.pdf
XX
RN   [3]
RP   1-73
RA   Nardini E., Mazzara M., Pinski G., Kreysa J.;
RT   "Event-specific Method for the Quantification of Cotton T304-40 Using Real-time PCR - Validation Report and Validated Method - Corrected Version 1";
RL   Online Publication (2012).
RX   DOI=10.2788/57952
XX
RN   [4]
RP   1-73
RT   "See Cross-references below";
RL   Online Publication (2010).
XX
DR   GMOMETHODS; QT-EVE-GH-006;
DR   GMOMETHODS; QT-EVE-GH-008;
DR   GMOMETHODS; QT-EVE-GH-009;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..73
FT                   /standard_name="PCR 73 bp amplicon"
FT                   /note="taxon-specific RT-PCR"
FT                   /target="alcohol dehydrogenase C (AdhC) gene"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: KVM157"
FT                   /note="CACATGACTTAGCCCATCTTTGC"
FT                   /target="AdhC"
FT   primer_bind     25..50
FT                   /standard_name="RT-PCR probe: TM012"
FT                   /note="VIC-TGCAGGTTTTGGTGCCACTGTGAATG-TAMRA"
FT   primer_bind     complement(53..73)
FT                   /standard_name="Primer reverse: KVM158"
FT                   /note="CCCACCCTTTTTTGGTTTAGC"
FT                   /target="AdhC"
XX
SQ   Sequence 73 BP; 18 A; 15 C; 19 G; 18 T; 3 other;
     cacatgactt agcccatctt tgcntgcagg ttttggtgcc actgtgaatg nngctaaacc        60
     aaaaaagggt ggg                                                           73
//