Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:ACS-BN002-5'
ID   QT-EVE-GH-003; SV 0; linear; genomic DNA; STS; SYN; 87 BP.
AC   MON-01445-2;
DT   16-OCT-2006
DT   20-OCT-2010
DE   Quantitative PCR method for detection of cotton event MON1445
DE   (Mazzara et al., 2008).
KW   event_specific.
OS   Gossypium hirsutum (upland cotton) - event MON1445 (MON-01445-2)
RN   [1]
RP   1-87
RA   Mazzara M., Bogni A., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line MON1445 Using Real-time PCR Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/4455
RN   [2]
RP   1-87
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GH-003.pdf
FH   Key             Location/Qualifiers
FT   STS             1..87
FT                   /standard_name="PCR 87 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of cotton event MON 1445 and the cotton host genome"
FT   primer_bind     1..26
FT                   /standard_name="Primer forward: MON1445 primer forward"
FT                   /target="5'-host genome"
FT   primer_bind     complement(36..64)
FT                   /standard_name="RT-PCR probe: MON1445 probe"
FT   primer_bind     complement(68..87)
FT                   /standard_name="Primer reverse: MON1445 primer reverse"
FT                   /note="ATCGACCTGCAGCCCAAGCT"
FT                   /target="insert"
SQ   Sequence 87 BP; 26 A; 14 C; 22 G; 13 T; 12 other;
     ggagtaagac gattcagatc aaacacnnnn nnnnnaaact gaaggcggga aacgacaatc        60
     tgatnnnagc ttgggctgca ggtcgat                                            87