An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-EVE-BN-002; SV 0; linear; genomic DNA; STS; SYN; 204 BP.
XX
AC   MON-00073-7;
XX
DT   23-JUN-2009
DT   03-OCT-2010
XX
DE   Qualitative PCR method for detection of oilseed rape event GT73
DE   (Pan et al., 2007).
XX
KW   event_specific.
XX
OS   Brassica napus (oilseed rape) - event GT73 (MON-00073-7)
XX
RN   [1]
RP   1-204
RA   Pan L., Zhang S., Yang L., Broll H., Tian F., Zhang D.;
RT   "Interlaboratory trial validation of an event-specific qualitative
RT   polymerase chain reaction-based detection method for genetically modified
RT   RT73 rapeseed";
RL   J AOAC Int 90:1639-1646 (2007).
RX   PUBMED; 18193742.
XX
RN   [2]
RP   1-204
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-EVE-BN-002.pdf
XX
DR   GMOMETHODS; QL-TAX-BN-004;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..204
FT                   /standard_name="PCR 204 bp amplicon"
FT                   /note="Event-specific PCR"
FT                   /target="3' integration border region (IBR) between the E9 gene terminator (T-E9) of oilseed rape event GT73 and the oilseed rape host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: RT73-1"
FT                   /note="AATAACGCTGCGGACATCTA"
FT                   /target="insert"
FT   primer_bind     complement(183..204)
FT                   /standard_name="Primer reverse: RT73-2"
FT                   /note="CAGCAAGATTCTCTGTCAACAA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 204 BP; 48 A; 48 C; 29 G; 79 T; 0 other;
     aataacgctg cggacatcta nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnttgttgac agagaatctt gctg                                              204
//