An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-BN-007; SV 0; linear; genomic DNA; STS; SYN; 104 BP.
XX
AC   ACS-BN002-5;
XX
DT   22-NOV-2011
DT   14-FEB-2008
XX
DE   Quantitative PCR method for detection of oilseed rape event Rf2 (verified by the EU-RL GMFF in the context of Commission Decision 2007/306/EC)
XX
KW   event_specific, EU-RL_GMFF_in-house_verified.
XX
OS   Brassica napus (oilseed rape) - event RF2 (ACS-BN002-5)
XX
RN   [1]
RP   1-104
RA   Mazzara M.,;
RT   "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF2 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2011).
RX   EURL_GMFF=Rf2 Validation Report.pdf
RX   EURL_GMFF=Rf2 Validated Method Protocol CRL-VL-1004.pdf
XX
RN   [2]
RP   1-104
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QT-EVE-BN-007.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-012;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..104
FT                   /standard_name="PCR 104 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5'integration border region (IBR) between the insert of oilseed rape event RF2 and the oilseed rape host genome";
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: MDB207"
FT                   /note="GGGTGAGACAATATATCGACG"
FT                   /target="5'-host genome"
FT   primer_bind     52..77
FT                   /standard_name="RT-PCR probe:  TM024"
FT                   /note="FAM-CACCGGCCAAATTCGCTCTTAGCCGT-TAMRA"                
FT   primer_bind     complement(87..104)
FT                   /standard_name="Primer reverse: KVM171"
FT                   /note="GGGCATCGCACCGGTGAG"
FT                   /target="insert"
XX
SQ   Sequence 104 BP; 29 A; 27 C; 21 G; 27 T; 0 other;
     gggtgagaca atatatcgac gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ncaccggcca        60
     aattcgctct tagccgtnnn nnnnnnctca ccggtgcgat gccc                        104
//