ID QT-CON-00-001; SV 0; linear; genomic DNA; STS; SYN; 121 BP. XX AC MON-04032-6; XX DT 15-SEP-2009 DT 05-OCT-2016 XX DE Quantitative PCR method for detection of the junction between the chloroplast transit peptide and the CP4 epsps gene. XX KW construct_specific. XX OS Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6) XX RN [1] RP 1-121 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-121 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-121 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-001.pdf XX DR GMOMETHODS; QT-TAX-GM-007; XX FH Key Location/Qualifiers FH FT STS 1..121 FT /standard_name="PCR 121 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene and the CP4 epsps gene from Agrobacterium tumefasciens" FT primer_bind 1..24 FT /standard_name="Primer forward: RRS 01-5'" FT /note="CCTTTAGGATTTCAGCATCAGTGG" FT /target="CTP" FT primer_bind 62..80 FT /standard_name="RT-PCR probe: RRS-Taq" FT /note="FAM-CGCAACCGCCCGCAAATCC-TAMRA" FT primer_bind complement(104..121) FT /standard_name="Primer reverse: RRS 01-3'" FT /note="GACTTGTCGCCGGGAATG" FT /target="CP4-EPSPS" XX SQ Sequence 121 BP; 23 A; 45 C; 29 G; 24 T; 0 other; cctttaggat ttcagcatca gtggnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 ncgcaaccgc ccgcaaatcc nnnnnnnnnn nnnnnnnnnn nnncattccc ggcgacaagt 120 c 121 //