Only one hit for query 'ac%3aMON-88701-3'
ID QT-TAX-GH-018; SV 0; linear; genomic DNA; STS; PLN; 73 BP. XX AC ; XX DT 30-JUN-2008 DT 19-NOV-2010 XX DE Quantitative PCR method for detection of cotton alcohol dehydrogenase C gene DE (Mazzara et al., 2007). XX KW taxon_specific, validated_in_combination. XX OS Gossypium hirsutum (upland cotton) XX RN [1] RP 1-73 RA Mazzara M., Grazioli E., Savini C., Van Den Eede G.; RT "Event-Specific Method for the Quantification of Cotton Line "LLCotton25" Using Real-time PCR - Validation Report and Protocol - Cotton Seeds Sampling and DNA Extraction"; RL Online Publication (2007). RX DOI=10.2788/32755 XX RN [2] RP 1-73 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-EVE-GH-002; XX FH Key Location/Qualifiers FH FT STS 1..73 FT /standard_name="PCR 73 bp amplicon" FT /note="taxon-specific RT-PCR" FT /target="alcohol dehydrogenase C (AdhC) gene" FT primer_bind 1..23 FT /standard_name="Primer forward: KVM157" FT /note="CACATGACTTAGCCCATCTTTGC" FT /target="AdhC" FT primer_bind 25..50 FT /standard_name="RT-PCR probe: TM012" FT /note="FAM-TGCAGGTTTTGGTGCCACTGTGAATG-TAMRA" FT primer_bind complement(53..73) FT /standard_name="Primer reverse: KVM158" FT /note="CCCACCCTTTTTTGGTTTAGC" FT /target="AdhC" XX SQ Sequence 73 BP; 18 A; 15 C; 19 G; 18 T; 3 other; cacatgactt agcccatctt tgcntgcagg ttttggtgcc actgtgaatg nngctaaacc 60 aaaaaagggt ggg 73 //