An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-GH-010; SV 0; linear; genomic DNA; STS; SYN; 84 BP.
XX
AC   MON-88701-3;
XX
DT   13-FEB-2013
DT   12-JUL-2016
XX
DE   Quantitative PCR method for detection of cotton event MON88701 (EURL GMFF, 2016).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event MON88701 (MON-88701-3)
XX
RN   [1]
RP   1-84
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Cotton MON88701 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RX   EURL_GMFF=EURL-VL-01-13-VR.pdf
RX   EURL_GMFF=MON-88701-Validated-Method.pdf
XX
RN   [2]
RP   1-84
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QT-EVE-GH-010.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-015;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..84
FT                   /standard_name="PCR 84 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="3' integration border region (IBR) between the insert of cotton event MON88701 and the cotton host genome"
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: MON 88701 primer 1"
FT                   /note="CATACTCATTGCTGATCCATGTAGA"
FT                   /target="insert"
FT   primer_bind     27..53
FT                   /standard_name="RT-PCR probe: MON 88701 probe"
FT                   /note="FAM-TTCCCGGACATGAAGCCTTAATTCAAT-TAMRA"
FT   primer_bind     complement(58..84)
FT                   /standard_name="Primer reverse: MON 88701 primer 2"
FT                   /note="AGTGTTAAACAAGTTATGTTCTAGAGC"
FT                   /target="3'-host genome"
XX
SQ   Sequence 84 BP; 25 A; 19 C; 12 G; 28 T; 0 other;
     catactcatt gctgatccat gtaganttcc cggacatgaa gccttaattc aatnnnngct        60
     ctagaacata acttgtttaa cact                                               84
//