An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-BN-004; SV 0; linear; genomic DNA; STS; PLN; 108 BP.
XX
AC   MON-00073-7;
XX
DT   01-JAN-1900
DT   19-OCT-2010
XX
DE   Quantitative PCR method for detection of oilseed rape event GT73
DE   (Mazzara et al., 2007).
XX
KW   event_specific.
XX
OS   Brassica napus (oilseed rape) - event GT73 (MON-00073-7)
XX
RN   [1]
RP   1-108
RA   Mazzara M., Grazioli E., Savini C., Van Den Eede G.;
RT   Event-Specific Method for the Quantification of Oilseed Rape Line RT73 Using Real-Time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction of Oilseed Rape;
RL   Online Publication (2007).
RX   DOI=10.2788/33974
XX
RN   [2]
RP   1-108
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-BN-004.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-012;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..108
FT                   /standard_name="PCR 108 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of oilseed rape event GT73 and the oilseed rape host genome"
FT   primer_bind     1..26
FT                   /standard_name="Primer forward: RT73 primer 1"
FT                   /note="CCATATTGACCATCATACTCATTGCT"
FT                   /target="insert"
FT   primer_bind     40..66
FT                   /standard_name="RT-PCR probe: RT73 Probe"
FT                   /note="FAM-TTCCCGGACATGAAGATCATCCTCCTT-TAMRA"
FT   primer_bind     complement(85..108)
FT                   /standard_name="Primer reverse: RT73 primer 2"
FT                   /note="GCTTATACGAAGGCAAGAAAAGGA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 108 BP; 16 A; 24 C; 9 G; 28 T; 31 other;
     ccatattgac catcatactc attgctnnnn nnnnnnnnnt tcccggacat gaagatcatc        60
     ctccttnnnn nnnnnnnnnn nnnntccttt tcttgccttc gtataagc                    108
//