ID QL-TAX-OS-002; SV 0; linear; mRNA; STS; PLN; 68 BP. XX AC ; XX DT 09-JUN-2008 DT 25-NOV-2021 XX DE Qualitative PCR method for detection of rice Phospholipase D alpha 2 gene. XX KW taxon_specific, validated_in_combination. XX OS Oryza sativa (rice) XX RN [1] RP 1-68 RA Mazzara M., Cordeil S., Van Den Eede G.; RT "Report on the Verification of an Event-specific Detection Method for Identification of Rice GM-event LLRICE601 Using a Real-time PCR Assay"; RL Online Publication (2006). RX EURL_GMFF=Verification Report LLRice601 event.pdf XX RN [2] RP 1-68 RA Bayer CropScience; RT "Grain testing method for detection of rice GM event LLRICE601 using RT-PCR protocols PGS0505 and PGS0476"; RL Online Publication (2006). RX CRL-DOC=P35S-bar sqRT-PCR - PGS0494-476 310806.pdf XX RN [3] RP 1-68 RA US Department of Agriculture; RT "Verification of the Bayer CropScience method for the detection of LL601 in rice using real-time PCR"; RL Online Publication (2006). RX CRL-DOC=35SBarRiceVerficationReportrev.pdf XX RN [4] RP 1-68 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Report on the Verification of a Construct-specific Detection Method for RT Identification of Rice GM-Events containing P35S::BAR using a Real-time RT PCR Assay"; RL Online Publication (2006). RX CRL-DOC=Verification Report 35S-BAR CRL.pdf XX RN [5] RP 1-68 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QL-EVE-OS-001; DR GMOMETHODS; QL-CON-00-015; XX FH Key Location/Qualifiers FH FT STS 1..68 FT /standard_name="PCR 68 bp amplicon" FT /note="taxon-specific RT-PCR" FT /target="phospholipase D (PLD) gene" FT primer_bind 1..20 FT /standard_name="Primer forward: KVM159" FT /note="TGGTGAGCGTTTTGCAGTCT" FT /target="PLD" FT primer_bind 22..44 FT /standard_name="RT-PCR probe: TM013" FT /note="VIC-TGTTGTGCTGCCAATGTGGCCTG-TAMRA" FT primer_bind complement(47..68) FT /standard_name="Primer reverse: KVM160" FT /note="CTGATCCACTAGCAGGAGGTCC" FT /target="PLD" XX SQ Sequence 68 BP; 8 A; 14 C; 22 G; 21 T; 3 other; tggtgagcgt tttgcagtct ntgttgtgct gccaatgtgg cctgnnggac ctcctgctag 60 tggatcag 68 //